龈沟产线菌调节CXCL3介导的中性粒细胞浸润加重实验性牙周炎的机制研究

doi:10.13591/j.cnki.kqyx.2026.07.001

Abstract

Abstract:

Objective To investigate the molecular mechanism by which Filifactor alocis (F. alocis) regulates neutrophil infiltration and exacerbates experimental periodontitis. Methods A F. alocis infection model was established in neutrophils. Neutrophil cytotoxicity under F. alocis stimulation was assessed using CCK-8 assay. RT-qPCR was performed to detect the mRNA expression of neutrophil chemokines (C-X-C motif chemokine ligand 1 (CXCL1), CXCL2, CXCL3, CXCL5, CXCL6, CXCL8, CXCL16) and inflammatory cytokines (tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), C-C motif chemokine ligand 2 (CCL2). CXCL3 secretion levels were measured using ELISA. The expression of CXCL3 in neutrophils was detected by cellular immunofluorescence. Chemotaxis was measured using Transwell assays. A mouse model of F. alocis-induced periodontitis was established by silk ligation around bilateral maxillary second molars combined with oral smearing of F. alocis. CXCL3 neutralizing antibody was administered by gingival injection. Alveolar bone destruction was assessed using Micro-CT, and the infiltration of lymphocyte antigen 6 complex locus G (Ly-6G)-positive neutrophils in periodontal tissues was detected by tissue immunofluorescence staining. Results F. alocis exhibited minimal cytotoxic effects on neutrophils at a multiplicity of infection (MOI) of 10 within a 6-hour co-culture period. F. alocis upregulated the mRNA expression of CXCL2, CXCL3, CXCL8, TNF-α, IL-1β and IL-6, while downregulating CCL2 expression, thereby enhancing neutrophil chemotaxis and inflammatory cytokine release. In vivo, F. alocis aggravated alveolar bone destruction and neutrophil infiltration in the periodontal tissues of periodontitis model mice. Notably, administration of a CXCL3-neutralizing antibody effectively suppressed this inflammatory process. Conclusion F. alocis promotes neutrophil recruitment into periodontal tissues via CXCL3, exacerbating alveolar bone destruction and tissue inflammation in periodontitis. These findings identify CXCL3 as a key chemokine mediating F. alocis pathogenicity and a potential therapeutic target.

Key words: Filifactor alocis, neutrophils, periodontitis, C-X-C motif chemokine ligand 3 (CXCL3)

CLC Number:

R781.4

ZHANG Qunbo, LI Cheng, REN Minyi, LI Lu. Filifactor alocis exacerbates experimental periodontitis by modulating CXCL3-mediated neutrophil infiltration[J]. Stomatology, 2026, 46(7): 481-488.

Figures/Tables 8

Tab.1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

Fig.7

References 34

[1]	Hajishengallis G. Periodontitis: From microbial immune subversion to systemic inflammation[J]. Nat Rev Immunol, 2015, 15(1): 30-44. doi: 10.1038/nri3785 pmid: 25534621
[2]	Aja E, Mangar M, Fletcher HM, et al. Filifactor alocis: Recent insights and advances[J]. J Dent Res, 2021, 100(8): 790-797. doi: 10.1177/00220345211000656
[3]	Aruni AW, Mishra A, Dou YT, et al. Filifactor alocis: A new emerging periodontal pathogen[J]. Microbes Infect, 2015, 17(7): 517-530. doi: 10.1016/j.micinf.2015.03.011
[4]	Oscarsson J, Claesson R, Bao K, et al. Phylogenetic analysis of Filifactor alocis strains isolated from several oral infections identified a novel RTX toxin, FtxA[J]. Toxins, 2020, 12(11): 687. doi: 10.3390/toxins12110687
[5]	Jusko M, Miedziak B, Ermert D, et al. FACIN, a double-edged sword of the emerging periodontal pathogen Filifactor alocis: A metabolic enzyme moonlighting as a complement inhibitor[J]. J Immunol, 2016, 197(8): 3245-3259. doi: 10.4049/jimmunol.1600739
[6]	Mishra A, Aja E, Fletcher HM. Role of superoxide reductase FA796 in oxidative stress resistance in Filifactor alocis[J]. Sci Rep, 2020, 10: 9178. doi: 10.1038/s41598-020-65806-3
[7]	Kim HY, Lim Y, An SJ, et al. Characterization and immunostimulatory activity of extracellular vesicles from Filifactor alocis[J]. Mol Oral Microbiol, 2020, 35(1): 1-9. doi: 10.1111/omi.v35.1
[8]	Kim HY, Song MK, Gho YS, et al. Extracellular vesicles derived from the periodontal pathogen Filifactor alocis induce systemic bone loss through Toll-like receptor 2[J]. J Extracell Vesicles, 2021, 10(12): e12157. doi: 10.1002/jev2.v10.12
[9]	Song MK, Kim HY, Choi BK, et al. Filifactor alocis-derived extracellular vesicles inhibit osteogenesis through TLR2 signaling[J]. Mol Oral Microbiol, 2020, 35(5): 202-210. doi: 10.1111/omi.v35.5
[10]	Yoo HJ, Lee SH. Virulence of Filifactor alocis lipoteichoic acid on human gingival fibroblast[J]. Arch Oral Biol, 2022, 135: 105370. doi: 10.1016/j.archoralbio.2022.105370
[11]	Zhang J, Chen BY, Zhi MF, et al. Linking oral microbiota to periodontitis and hypertension unveils that Filifactor alocis aggravates hypertension via infiltration of interferon-γ⁺ T cells[J]. m Systems, 2025, 10(6): e00084-e00025.
[12]	王雪奎, 孙瑶. 中性粒细胞与牙周炎关系的研究进展[J]. 口腔医学, 2024, 44(4): 292-296.
[13]	Qiu W, Guo RM, Yu HW, et al. Single-cell atlas of human gingiva unveils a NETs-related neutrophil subpopulation regulating periodontal immunity[J]. J Adv Res, 2025, 72: 287-301. doi: 10.1016/j.jare.2024.07.028
[14]	Song J, Zhang YN, Bai YY, et al. The deubiquitinase OTUD1 suppresses secretory neutrophil polarization and ameliorates immunopathology of periodontitis[J]. Adv Sci, 2023, 10(30): 2303207. doi: 10.1002/advs.v10.30
[15]	Capucetti A, Albano F, Bonecchi R. Multiple roles for chemokines in neutrophil biology[J]. Front Immunol, 2020, 11: 1259. doi: 10.3389/fimmu.2020.01259 pmid: 32733442
[16]	Dahlstrand Rudin A, Khamzeh A, Venkatakrishnan V, et al. Porphyromonas gingivalis produce neutrophil specific chemoattractants including short chain fatty acids[J]. Front Cell Infect Microbiol, 2021, 10: 620681. doi: 10.3389/fcimb.2020.620681
[17]	Vashishta A, Li L, Srivastava S, et al. Filifactor alocis pathogenicity requires TLR2 and the oral microbiome[J]. J Dent Res, 2025, 104(11): 1248-1256. doi: 10.1177/00220345251331959
[18]	Miralda I, Vashishta A, Rogers MN, et al. Whole transcriptome analysis reveals that Filifactor alocis modulates TNFα-stimulated MAPK activation in human neutrophils[J]. Front Immunol, 2020, 11: 497. doi: 10.3389/fimmu.2020.00497 pmid: 32373107
[19]	Yao YF, Yin YJ, Shuai FY, et al. M2 macrophage-derived extracellular vesicles reprogram immature neutrophils into Anxa1^hi neutrophils to enhance inflamed bone regeneration[J]. Adv Sci, 2025, 12(28): 2416159. doi: 10.1002/advs.v12.28
[20]	Chen H, Liu Y, Zhang MH, et al. A Filifactor alocis-centered co-occurrence group associates with periodontitis across different oral habitats[J]. Sci Rep, 2015, 5: 9053. doi: 10.1038/srep09053 pmid: 25761675
[21]	Nogueira AVB, Nokhbehsaim M, Damanaki A, et al. Filifactor alocis and tumor necrosis factor-alpha stimulate synthesis of visfatin by human macrophages[J]. Int J Mol Sci, 2021, 22(3): 1235. doi: 10.3390/ijms22031235
[22]	Gutierrez LS, Zandim-Barcelos DL, Eick S, et al. Possible immunomodulatory role of Filifactor alocis through beta-defensin 2 in gingival keratinocytes[J]. Clin Oral Investig, 2024, 28(12): 658. doi: 10.1007/s00784-024-06043-0
[23]	Cardisciani M, Di Nicolantonio S, Altamura S, et al. Temporal dynamics of early inflammatory markers after professional dental cleaning: A meta-analysis and spline-based meta-regression of TNF-α, IL-1β, IL-6, and (hs)CRP[J]. Front Immunol, 2025, 16: 1634622. doi: 10.3389/fimmu.2025.1634622
[24]	Adamik J, Wang KZQ, Unlu S, et al. Distinct mechanisms for induction and tolerance regulate the immediate early genes encoding interleukin 1β and tumor necrosis factor α[J]. PLoS One, 2013, 8(8): e70622. doi: 10.1371/journal.pone.0070622
[25]	Lee A, Qiao Y, Grigoriev G, et al. Tumor necrosis factor α induces sustained signaling and a prolonged and unremitting inflammatory response in rheumatoid arthritis synovial fibroblasts[J]. Arthritis Rheum, 2013, 65(4): 928-938. doi: 10.1002/art.v65.4
[26]	Kalliolias GD, Ivashkiv LB. TNF biology, pathogenic mechanisms and emerging therapeutic strategies[J]. Nat Rev Rheumatol, 2016, 12(1): 49-62. doi: 10.1038/nrrheum.2015.169 pmid: 26656660
[27]	Fu LL, Yin CH, Zhao Q, et al. CD81⁺ senescent-like fibroblasts exaggerate inflammation and activate neutrophils via C3/C3aR1 axis in periodontitis[J]. eLife, 2025, 13: RP96908.
[28]	Sokulsky LA, Garcia-Netto K, Nguyen TH, et al. A critical role for the CXCL3/CXCL5/CXCR2 neutrophilic chemotactic axis in the regulation of type 2 responses in a model of rhinoviral-induced asthma exacerbation[J]. J Immunol, 2020, 205(9): 2468-2478. doi: 10.4049/jimmunol.1901350 pmid: 32948685
[29]	Wang HH, Zhang BY, Li RQ, et al. KIAA1199 drives immune suppression to promote colorectal cancer liver metastasis by modulating neutrophil infiltration[J]. Hepatology, 2022, 76(4): 967-981. doi: 10.1002/hep.32383 pmid: 35108400
[30]	Szmydynger-Chodobska J, Strazielle N, Zink BJ, et al. The role of the choroid plexus in neutrophil invasion after traumatic brain injury[J]. J Cereb Blood Flow Metab, 2009, 29(9): 1503-1516. doi: 10.1038/jcbfm.2009.71
[31]	Qian J, Tao Q, Shen Y, et al. Periodontitis salivary microbiota exacerbates colitis by CXCL3 derived from gut microbiota-induced macrophages[J]. Microbiome, 2025, 13(1): 255. doi: 10.1186/s40168-025-02218-3
[32]	Armstrong CL, Miralda I, Neff AC, et al. Filifactor alocis promotes neutrophil degranulation and chemotactic activity[J]. Infect Immun, 2016, 84(12): 3423-3433. pmid: 27647870
[33]	Zhao YF, Zuo ZA, Li ZY, et al. Integrated multi-omics profiling reveals neutrophil extracellular traps potentiate aortic dissection progression[J]. Nat Commun, 2024, 15(1): 10736. doi: 10.1038/s41467-024-55038-8
[34]	Miralda I, Vashishta A, Uriarte SM. Neutrophil interaction with emerging oral pathogens: A novel view of the disease paradigm[J]. Adv Exp Med Biol, 2019, 1197: 165-178. doi: 10.1007/978-3-030-28524-1_12 pmid: 31732941

基因名称	引物序列(5'—3')
CXCL1	F:CTTGCCTCAATCCTGCATCCC R:GAACAGCCACCAGTGAGCTTC
CXCL2	F:CCAAACCGAAGTCATAGCCACA R:CTTCTGGTCAGTTGGATTTGCCAT
CXCL3	F:GCCCAAACCGAAGTCATAGCC R:CTCTCCTGTCAGTTGGTGCTC
CXCL5	F:CAGACCACGCAAGGAGTTCA R:TCTTCAGGGAGGCTACCACT
CXCL6	F:CCTGAAGAACGGGAAGCAAG R:AGAAAACTGCTCCGCTGAAG
CXCL8	F:TCAGAGACAGCAGAGCACAC R:GTTCTTTAGCACTCCTTGGCAAA
CXCL16	F:CTCCTGCTGGTGTACCTGAC R:AGGAGCTGGAACCTCGTGTA
TNF-α	F:CAGCCTCTTCTCCTTCCTGAT R:GCCAGAGGGCTGATTAGAGA
IL-1β	F:TACCTCTCCTGCGTGTTGAA R:TCTTTGGGTAATTTTTGGGATCT
IL-6	F:ACTCACCTCTTCAGAACGAATTG R:CCATCTTTGGAAGGTTCAGGTTG
CCL2	F:CCCCAGTCACCTGCTGTTAT R:CCACAATGGTCTTGAAGATCAC
GAPDH	F:CTTTGGTATCGTGGAAGGACTC R:GTAGAGGCAGGGATGATGTTC

Filifactor alocis exacerbates experimental periodontitis by modulating CXCL3-mediated neutrophil infiltration

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 34

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	SHANG Wenjia, YANG Fanghong, GAO Hui, DAI Bingfeng, YANG Xiaochuan. Research on the mechanism of triptolide in meliorating Fusobacterium nucleatum-related periodontitis [J]. Stomatology, 2026, 46(7): 489-494.
[2]	DAI Shuyue, ZHANG Xiya, CHEN Jian, ZHANG Qinyu, ZHOU Yiyi, BI Mengfei, SHEN Ming. Correlation between LAPTM5 expression and macrophage infiltration in the progression of periodontitis [J]. Stomatology, 2026, 46(7): 495-503.
[3]	CHEN Jian, DAI Shuyue, ZHANG Qinyu, ZHOU Yiyi, BI Mengfei, SHEN Ming. The role of ATF6 in macrophage-mediated periodontitis progression [J]. Stomatology, 2026, 46(6): 416-421.
[4]	WANG Chunxiao, HUANG You, LIU Yan. Study on the effects of biological antimicrobial peptides on periodontitis factors and bone metabolism indicators [J]. Stomatology, 2026, 46(6): 422-426.
[5]	LI Yuanfeng, QIAN Yuanyi, HUANG Yanli, DING Peihui. Research progress of lysosome and its dysfunction in periodontitis [J]. Stomatology, 2026, 46(6): 460-465.
[6]	LONG Yulin, LI Qingcun, YIN Guoqiang, BAO Yaoguang, GE Liming, MU Changdao, XU Zhilang, LI Defu. Application and exploration of hydrogels in the repair of periodontitis-induced bone defects [J]. Stomatology, 2026, 46(5): 395-400.
[7]	CHEN Yingyu, LIU Mao, HU Yuheng, CAO Dan, GU Minfen, HU Danyan, WU Bin, YAN Bin. A study on the compositional differences of healthy and periodontitis-affected alveolar bone based on Raman spectroscopy [J]. Stomatology, 2026, 46(4): 241-245.
[8]	HAN Dong, YANG Shuhan, YU Xinhong, XIE Weili. The role of cimifugin in regulating macrophage polarization in periodontitis [J]. Stomatology, 2026, 46(4): 246-252.
[9]	ZHANG Kewei, WANG Feiyang, LI Jiaojiao, YANG Chen, CHEN Wu, LI Lin, SHI Wenhui, CHEN Xiaomei, WANG Xiaoqian. Study on clinical effect of digital occlusal guided periodontal splint for periodontitis patients with loose teeth [J]. Stomatology, 2026, 46(4): 253-259.
[10]	GAO Han, ZHOU Yue. Research progress of PKM2-mediated regulatory pathways in periodontitis [J]. Stomatology, 2026, 46(2): 148-151.
[11]	SHEN Weiwei, ZHONG Liangjun. Progress of research on the mechanism of obesity’s impact on periodontitis [J]. Stomatology, 2026, 46(2): 152-155.
[12]	JIANG Yuhan, YOU Pinzhe, ZHAO Xueyun, LIN Mohan, SHI Bowei, PU Junlin, JIA Bo. A study on bergapten anti-inflammatory inhibition of bone resorption in the treatment of periodontitis [J]. Stomatology, 2025, 45(9): 667-674.
[13]	LI Haoyu, WU Yikuan, DING Peihui, LI Xiaojun. Research progress of the correlation between periodontal pathogens and gastrointestinal tumors [J]. Stomatology, 2025, 45(9): 691-695.
[14]	HAO Yandi, LIU Ye, GAO Pengyu, YANG Jingshu, XU Quanchen. Research progress of the relationship between macrophages and periodontitis [J]. Stomatology, 2025, 45(9): 696-700.
[15]	HE Mengke, LU Jiawei, DUAN Hui, LUO Lijun. Progress of research on artificial intelligence technology in radiographic diagnosis of periodontitis [J]. Stomatology, 2025, 45(6): 460-464.