转录因子TBX1调控人牙髓间充质干细胞成骨分化的作用研究

Abstract

Abstract:

Objective To investigate the regulatory effect of T-box transcription factor 1 (TBX1) on the osteogenic differentiation capacity of human dental pulp stem cells (hDPSCs) and its underlying mechanism. Methods In vitro, a TBX1-knockdown hDPSCs model was constructed using lentiviral transfection. Alkaline phosphatase (ALP) staining was performed to assess early osteogenic differentiation, and alizarin red S (ARS) staining was used to observe mineralized nodule formation at the late stage. The expression levels of osteogenic markers including collagen type Ⅰ (COL1), osterix (OSX), and Runt-related transcription factor 2 (RUNX2) were detected by Western blot and RT-qPCR. Conditioned medium collected on day 7 of osteogenic induction was used for tube formation assay with human umbilical vein endothelial cells (HUVECs), and the mRNA expression levels of vascular endothelial growth factor A (VEGFA), angiopoietin-1 (ANG1), and platelet-derived growth factor subunit B (PDGFB) were detected by RT-qPCR. In vivo, an ectopic osteogenesis model was established in nude mice by subcutaneous implantation on the dorsum. The mice were randomly divided into control group (consh) and TBX1 knockdown group (TBX1sh), which received composites of HA/TCP scaffolds seeded with hDPSCs transfected with consh or TBX1sh, respectively. HE staining was performed to compare the differences in new bone formation between the control and TBX1 knockdown groups. Immunohistochemi-cal staining was conducted to detect the expression of osteogenesis-related proteins, including RUNX2, osteocalcin(OCN), bone sialoprotein(BSP), and platelet endothelial cell adhesion molecule (CD31). Results In vitro experiments showed that TBX1 knockdown significantly enhanced ALP activity, mineralized nodule formation, and the expression of osteogenic differentiation markers (COL1, OSX, RUNX2) in hDPSCs(P<0.05). Additionally, the mRNA levels of VEGFA, ANG1, and PDGFB were significantly upregulated (P<0.05), and the conditioned medium from TBX1-knockdown hDPSCs markedly promoted the formation of tubular structures in HUVECs (P<0.05). In vivo results demonstrated increased new bone formation and upregulated expression of osteogenic-related proteins in the TBX1-knockdown group (P<0.05). CD31 immunohistochemical staining showed that both microvessel density and integrated optical density were significantly higher in the TBX1-knockdown group compared to the control group (P<0.05). Conclusion TBX1 is a negative regulator of osteogenic differentiation in hDPSCs. Knockdown of TBX1 effectively promotes the osteogenic differentiation of hDPSCs, and the underlying mechanism may involve enhanced pro-angiogenic capacity and improved local microenvironment.

Key words: TBX1, human dental pulp stem cells (hDPSCs), osteogenic differentiation, bone regeneration

CLC Number:

R781.3

WANG Mingxi, GAO Shan, LI Guoqing, TANG Chunbo. Regulatory effect of transcription factor TBX1 on osteogenic differentiation of human dental pulp stem cells[J]. Stomatology, 2026, 46(6): 427-434.

Figures/Tables 11

Tab.1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

Fig.7

Fig.8

Fig.9

Fig.10

References 32

[1]	Raymond Y, Pastorino D, Ginebreda I, et al. Computed tomography and histological evaluation of xenogenic and biomimetic bone grafts in three-wall alveolar defects in minipigs[J]. Clin Oral Investig, 2021, 25(12): 6695-6706. doi: 10.1007/s00784-021-03956-y
[2]	Zhao J, Zhou YH, Zhao YQ, et al. Oral cavity-derived stem cells and preclinical models of jaw-bone defects for bone tissue engineering[J]. Stem Cell Res Ther, 2023, 14(1): 39. doi: 10.1186/s13287-023-03265-z pmid: 36927449
[3]	Apatzidou DA, Iliopoulos JM, Konstantinidis A, et al. Inflammatory and bone remodelling related biomarkers following periodontal transplantation of the tissue engineered bio complex[J]. Clin Oral Investig, 2024, 28(7): 361. doi: 10.1007/s00784-024-05754-8
[4]	Wang WQ, Yang HQ, Fan ZP, et al. NQO1 promotes osteogenesis and suppresses angiogenesis in DPSCs via MAPK pathway modulation[J]. Stem Cell Res Ther, 2024, 15(1): 306. doi: 10.1186/s13287-024-03929-4
[5]	Zheng XY, Wang J, Zhou H, et al. Dental pulp stem cells alleviate Schwann cell pyroptosis via mitochondrial transfer to enhance facial nerve regeneration[J]. Bioact Mater, 2025, 47: 313-326.
[6]	袁忠治, 胡伟平. 牙髓干细胞对中枢神经系统疾病的治疗新进展[J]. 口腔医学, 2018, 38(5): 471-475.
[7]	Liu Y, Liu YT, Hu JC, et al. Impact of allogeneic dental pulp stem cell injection on tissue regeneration in periodontitis: A multicenter randomized clinical trial[J]. Signal Transduct Target Ther, 2025, 10(1): 239.
[8]	Yu JH, He HX, Tang CB, et al. Differentiation potential of STRO-1⁺ dental pulp stem cells changes during cell passaging[J]. BMC Cell Biol, 2010, 11: 32. doi: 10.1186/1471-2121-11-32
[9]	Tatullo M, Marrelli M, Shakesheff KM, et al. Dental pulp stem cells: Function, isolation and applications in regenerative medicine[J]. J Tissue Eng Regen Med, 2015, 9(11): 1205-1216. doi: 10.1002/term.1899 pmid: 24850632
[10]	Cen HM, Luo H, Luo B, et al. TBX1 regulates myogenic differentiation by activating the TGFβ-Smad2/3 pathway in myoblasts[J]. Exp Biol Med, 2023, 248(1): 61-69. doi: 10.1177/15353702221112087
[11]	Eom TY, Schmitt JE, Li YR, et al. Tbx1 haploinsufficiency leads to local skull deformity, paraflocculus and flocculus dysplasia, and motor-learning deficit in 22q11.2 deletion syndrome[J]. Nat Commun, 2024, 15(1): 10510. doi: 10.1038/s41467-024-54837-3
[12]	Fulcoli FG, Franzese M, Liu XY, et al. Rebalancing gene haploinsufficiency in vivo by targeting chromatin[J]. Nat Commun, 2016, 7: 11688. doi: 10.1038/ncomms11688
[13]	Dastjerdi A, Robson L, Walker R, et al. Tbx1 regulation of myogenic differentiation in the limb and cranial mesoderm[J]. Dev Dyn, 2007, 236(2): 353-363. doi: 10.1002/dvdy.v236:2
[14]	Kelly RG, Jerome-Majewska LA, Papaioannou VE. The del22q11.2 candidate gene Tbx1 regulates branchiomeric myogenesis[J]. Hum Mol Genet, 2004, 13(22): 2829-2840. pmid: 15385444
[15]	Khotib J, Marhaeny HD, Miatmoko A, et al. Differentiation of osteoblasts: The links between essential transcription factors[J]. J Biomol Struct Dyn, 2023, 41(19): 10257-10276. doi: 10.1080/07391102.2022.2148749
[16]	Hilkens P, Gervois P, Fanton Y, et al. Effect of isolation methodology on stem cell properties and multilineage differentiation potential of human dental pulp stem cells[J]. Cell Tissue Res, 2013, 353(1): 65-78. doi: 10.1007/s00441-013-1630-x pmid: 23715720
[17]	Wang W, Zhu YR, Liu Y, et al. 3D bioprinting of DPSCs with GelMA hydrogel of various concentrations for bone regeneration[J]. Tissue Cell, 2024, 88: 102418. doi: 10.1016/j.tice.2024.102418
[18]	Mattei V, Martellucci S, Pulcini F, et al. Regenerative potential of DPSCs and revascularization: Direct, paracrine or autocrine effect?[J]. Stem Cell Rev Rep, 2021, 17(5): 1635-1646. doi: 10.1007/s12015-021-10162-6 pmid: 33829353
[19]	Leyendecker Junior A, Gomes Pinheiro CC, Lazzaretti Fernandes T, et al. The use of human dental pulp stem cells for in vivo bone tissue engineering: A systematic review[J]. J Tissue Eng, 2018, 9: 2041731417752766.
[20]	Liu FQ, Wu QQ, Liu QW, et al. Dental pulp stem cells-derived cannabidiol-treated organoid-like microspheroids show robust osteogenic potential via upregulation of WNT6[J]. Commun Biol, 2024, 7(1): 972. doi: 10.1038/s42003-024-06655-y
[21]	Kornsuthisopon C, Nowwarote N, Srisuwan T, et al. Regulatory pathways governing odonto/osteogenic differentiation in dental pulp stem cells[J]. Int Endod J, 2026, 59(3): 372-395. doi: 10.1111/iej.v59.3
[22]	Aval SF, Lotfi H, Sheervalilou R, et al. Tuning of major signaling networks (TGF-β, Wnt, Notch and Hedgehog) by miRNAs in human stem cells commitment to different lineages: Possible clinical application[J]. Biomed Pharmacother, 2017, 91: 849-860. doi: S0753-3322(17)31198-8 pmid: 28501774
[23]	Jerome LA, Papaioannou VE. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1[J]. Nat Genet, 2001, 27(3): 286-291. doi: 10.1038/85845 pmid: 11242110
[24]	Komori T. Whole aspect of Runx2 functions in skeletal development[J]. Int J Mol Sci, 2022, 23(10): 5776. doi: 10.3390/ijms23105776
[25]	Funato N, Srivastava D, Shibata S, et al. TBX1 regulates chondrocyte maturation in the spheno-occipital synchondrosis[J]. J Dent Res, 2020, 99(10): 1182-1191. doi: 10.1177/0022034520925080 pmid: 32442036
[26]	Papangeli I, Scambler P. The 22q11 deletion: DiGeorge and velocardiofacial syndromes and the role of TBX1[J]. Wiley Interdiscip Rev Dev Biol, 2013, 2(3): 393-403. doi: 10.1002/wdev.v2.3
[27]	Komori T. Regulation of skeletal development and maintenance by Runx2 and Sp7[J]. Int J Mol Sci, 2024, 25(18): 10102. doi: 10.3390/ijms251810102
[28]	Shen JJ, Sun Y, Liu XZ, et al. EGFL6 regulates angiogenesis and osteogenesis in distraction osteogenesis via Wnt/β-catenin signaling[J]. Stem Cell Res Ther, 2021, 12(1): 415. doi: 10.1186/s13287-021-02487-3
[29]	Cioffi S, Martucciello S, Fulcoli FG, et al. Tbx1 regulates brain vascularization[J]. Hum Mol Genet, 2014, 23(1): 78-89. doi: 10.1093/hmg/ddt400 pmid: 23945394
[30]	Lungu CN, Mehedinti MC. Molecular motifs in vascular morphogenesis: Vascular endothelial growth factor A (VEGFA) as the leading promoter of angiogenesis[J]. Int J Mol Sci, 2023, 24(15): 12169. doi: 10.3390/ijms241512169
[31]	Scott MA, Levi B, Askarinam A, et al. Brief review of models of ectopic bone formation[J]. Stem Cells Dev, 2012, 21(5): 655-667. doi: 10.1089/scd.2011.0517 pmid: 22085228
[32]	Burckhardt K, Jung O, Stošić MR, et al. Comparative evaluation of biocompatibility data from the subcutaneous and the calvaria implantation model of a novel bone substitute block[J]. In Vivo, 2025, 39(6): 3116-3127. doi: 10.21873/invivo.14113

基因	引物序列(5'-3')
TBX1	F:GCTGTGGGACGAGTTCAATC R:ACGTGGGGAACATTCGTCT
COL1	F:GCTACTACCGGGCTGATGAT R:ATGTTCTCGATCTGCTGGCT
OSX	F:CCCACCTCAGGCTATGCTAA R:CATGGATGCCTGCCTTGTAC
RUNX2	F:TGAACTCTGCACCAAGTCCT R:GGGTGGTAGAGTGGATGGAC
GAPDH	F:TCGTGGAAGGACTCATGACC R:ATGATGTTCTGGAGAGCCCC
VEGFA	F:GTGAGGTTTGATCCGCATGAT R:GACCCTGGCTTTACTGCTGTA
ANG1	F:CTACCAACAACAACAGCATCC R:CTCCCTTTAGCAAAACACCTTC
PDGFB	F:ATGAAATGCTGAGCGACCAC G:TCCCTCGAGATGAGCTTTCC

Regulatory effect of transcription factor TBX1 on osteogenic differentiation of human dental pulp stem cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 11

References 32

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	WANG Jie, LI Na, YU Jinhua. Coffee inhibits osteogenic differentiation of rat bone marrow mesenchymal stem cells via suppression of the Wnt/β-catenin pathway [J]. Stomatology, 2026, 46(5): 337-343.
[2]	JIANG Yanqing, JI Aomei, HAN Zhen, LIU Yang, GUO Songsong, XU Rongyao, ZHANG Ping, JIANG Hongbing. The impact of bilateral temporomandibular joint disc repositioning on mandibular morphology and position [J]. Stomatology, 2026, 46(5): 369-374.
[3]	LONG Yulin, LI Qingcun, YIN Guoqiang, BAO Yaoguang, GE Liming, MU Changdao, XU Zhilang, LI Defu. Application and exploration of hydrogels in the repair of periodontitis-induced bone defects [J]. Stomatology, 2026, 46(5): 395-400.
[4]	WANG Xiaolei, SU Chang, ZHOU Zhongzheng, QIN Di, HUI Guangyan, WANG Zhongshan, WU Guangsheng. A comparative study on fish scales and Bio-Oss bone powder on osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration in vivo [J]. Stomatology, 2026, 46(2): 112-117.
[5]	LAI Minqin, HU Zonghao, QIN Zishun, YIN Lihua. Effects of paeoniflorin on proliferation and osteogenic differentiation of human jaw bone marrow mesenchymal stem cells in vitro [J]. Stomatology, 2026, 46(2): 118-125.
[6]	ZHANG Yuchen, LI Meng, LI Ang, PEI Dandan. Progress in the application of amorphous calcium phosphate in bone regeneration materials: From in vivo regulatory mechanisms to biomimetic material construction [J]. Stomatology, 2026, 46(2): 81-88.
[7]	XIAO Long, HU Weiqiang, LIN Xuxin, HE Mengjiao, LUO Kai, XU Xiongcheng. Effects of nanosilicate functionalized polycaprolactone membrane on bone mesenchymal stem cells-induced bone repairing [J]. Stomatology, 2025, 45(8): 567-575.
[8]	YU Chen, HE Longfei, FENG Yao, GE Xiao, CUI Yunting, LI Ti, YU Miao. The effect of Nel-like type 1 molecule on the proliferation and osteogenic differentiation of stem cells from human exfoliated deciduous teeth [J]. Stomatology, 2025, 45(7): 518-524.
[9]	WU Yuting, DAI Mingrui, LENG Diya, ZHU Tingting, WU Tao, WU Daming. Study on the promotion of osteo/odontogenic differentiation on SCAPs and anti-inflammatory effects of EGCG/CeO₂-loaded nanoparticles in an inflammatory microenvironment [J]. Stomatology, 2025, 45(7): 529-539.
[10]	GENG Mingzhu, MU Wenqing, QIU Lin, ZHANG Wei. miR-129-1-3p inhibits osteogenic differentiation of human bone marrow mesenchymal stem cells via BMP2/SMAD1 signaling pathway [J]. Stomatology, 2025, 45(6): 418-423.
[11]	ZHANG Tianyi, ZHENG Yi, LYU Wenhao, MA Ning. Research progress of double network hydrogel in the field of bone regeneration [J]. Stomatology, 2025, 45(1): 69-74.
[12]	DONG Weijie, SU Tingshu, XIN Xianzhen. Effects of quercetin loaded gelatin microspheres on proliferation and differentiation of MC3T3-E1 [J]. Stomatology, 2024, 44(7): 494-499.
[13]	PAN Le, DUAN Qinyan, CHENG Junxiang, HONG Feng, HU Yajun. Research progress of LncRNA-mediated miRNA regulating osteogenic differentiation of PDLSCs in microenvironment [J]. Stomatology, 2024, 44(3): 232-236.
[14]	DING Kexin, YANG Jinxin, MOU Jie, SUN Zhe, CUI Yawen, LIU Zongxiang. In vitro study on flavonoid NO donor nanoparticles promoting osteogenic differentiation of PDLSCs by regulating macrophage polarization [J]. Stomatology, 2024, 44(11): 806-814.
[15]	ZHAO Piao, GUAN Xiaoyan, LIU Jianguo, XIANG Mingli, XIAO Linlin. Synergistic effect of LIPUS and its application in oral cavity [J]. Stomatology, 2024, 44(10): 780-785.