Stomatology ›› 2026, Vol. 46 ›› Issue (6): 427-434.
• Basic and Clinical Research • Previous Articles Next Articles
WANG Mingxi1,2,3, GAO Shan1,2,3, LI Guoqing1,2,3(
), TANG Chunbo1,2,3(
)
Received:2025-12-24
Online:2026-06-28
Published:2026-06-17
CLC Number:
WANG Mingxi, GAO Shan, LI Guoqing, TANG Chunbo. Regulatory effect of transcription factor TBX1 on osteogenic differentiation of human dental pulp stem cells[J]. Stomatology, 2026, 46(6): 427-434.
Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks
Tab.1
The primers used for RT-qPCR"
| 基因 | 引物序列(5'-3') |
|---|---|
| TBX1 | F:GCTGTGGGACGAGTTCAATC R:ACGTGGGGAACATTCGTCT |
| COL1 | F:GCTACTACCGGGCTGATGAT R:ATGTTCTCGATCTGCTGGCT |
| OSX | F:CCCACCTCAGGCTATGCTAA R:CATGGATGCCTGCCTTGTAC |
| RUNX2 | F:TGAACTCTGCACCAAGTCCT R:GGGTGGTAGAGTGGATGGAC |
| GAPDH | F:TCGTGGAAGGACTCATGACC R:ATGATGTTCTGGAGAGCCCC |
| VEGFA | F:GTGAGGTTTGATCCGCATGAT R:GACCCTGGCTTTACTGCTGTA |
| ANG1 | F:CTACCAACAACAACAGCATCC R:CTCCCTTTAGCAAAACACCTTC |
| PDGFB | F:ATGAAATGCTGAGCGACCAC G:TCCCTCGAGATGAGCTTTCC |
| [1] |
Raymond Y, Pastorino D, Ginebreda I, et al. Computed tomography and histological evaluation of xenogenic and biomimetic bone grafts in three-wall alveolar defects in minipigs[J]. Clin Oral Investig, 2021, 25(12): 6695-6706.
doi: 10.1007/s00784-021-03956-y |
| [2] |
Zhao J, Zhou YH, Zhao YQ, et al. Oral cavity-derived stem cells and preclinical models of jaw-bone defects for bone tissue engineering[J]. Stem Cell Res Ther, 2023, 14(1): 39.
doi: 10.1186/s13287-023-03265-z pmid: 36927449 |
| [3] |
Apatzidou DA, Iliopoulos JM, Konstantinidis A, et al. Inflammatory and bone remodelling related biomarkers following periodontal transplantation of the tissue engineered bio complex[J]. Clin Oral Investig, 2024, 28(7): 361.
doi: 10.1007/s00784-024-05754-8 |
| [4] |
Wang WQ, Yang HQ, Fan ZP, et al. NQO1 promotes osteogenesis and suppresses angiogenesis in DPSCs via MAPK pathway modulation[J]. Stem Cell Res Ther, 2024, 15(1): 306.
doi: 10.1186/s13287-024-03929-4 |
| [5] | Zheng XY, Wang J, Zhou H, et al. Dental pulp stem cells alleviate Schwann cell pyroptosis via mitochondrial transfer to enhance facial nerve regeneration[J]. Bioact Mater, 2025, 47: 313-326. |
| [6] | 袁忠治, 胡伟平. 牙髓干细胞对中枢神经系统疾病的治疗新进展[J]. 口腔医学, 2018, 38(5): 471-475. |
| [7] | Liu Y, Liu YT, Hu JC, et al. Impact of allogeneic dental pulp stem cell injection on tissue regeneration in periodontitis: A multicenter randomized clinical trial[J]. Signal Transduct Target Ther, 2025, 10(1): 239. |
| [8] |
Yu JH, He HX, Tang CB, et al. Differentiation potential of STRO-1+ dental pulp stem cells changes during cell passaging[J]. BMC Cell Biol, 2010, 11: 32.
doi: 10.1186/1471-2121-11-32 |
| [9] |
Tatullo M, Marrelli M, Shakesheff KM, et al. Dental pulp stem cells: Function, isolation and applications in regenerative medicine[J]. J Tissue Eng Regen Med, 2015, 9(11): 1205-1216.
doi: 10.1002/term.1899 pmid: 24850632 |
| [10] |
Cen HM, Luo H, Luo B, et al. TBX1 regulates myogenic differentiation by activating the TGFβ-Smad2/3 pathway in myoblasts[J]. Exp Biol Med, 2023, 248(1): 61-69.
doi: 10.1177/15353702221112087 |
| [11] |
Eom TY, Schmitt JE, Li YR, et al. Tbx1 haploinsufficiency leads to local skull deformity, paraflocculus and flocculus dysplasia, and motor-learning deficit in 22q11.2 deletion syndrome[J]. Nat Commun, 2024, 15(1): 10510.
doi: 10.1038/s41467-024-54837-3 |
| [12] |
Fulcoli FG, Franzese M, Liu XY, et al. Rebalancing gene haploinsufficiency in vivo by targeting chromatin[J]. Nat Commun, 2016, 7: 11688.
doi: 10.1038/ncomms11688 |
| [13] |
Dastjerdi A, Robson L, Walker R, et al. Tbx1 regulation of myogenic differentiation in the limb and cranial mesoderm[J]. Dev Dyn, 2007, 236(2): 353-363.
doi: 10.1002/dvdy.v236:2 |
| [14] |
Kelly RG, Jerome-Majewska LA, Papaioannou VE. The del22q11.2 candidate gene Tbx1 regulates branchiomeric myogenesis[J]. Hum Mol Genet, 2004, 13(22): 2829-2840.
pmid: 15385444 |
| [15] |
Khotib J, Marhaeny HD, Miatmoko A, et al. Differentiation of osteoblasts: The links between essential transcription factors[J]. J Biomol Struct Dyn, 2023, 41(19): 10257-10276.
doi: 10.1080/07391102.2022.2148749 |
| [16] |
Hilkens P, Gervois P, Fanton Y, et al. Effect of isolation methodology on stem cell properties and multilineage differentiation potential of human dental pulp stem cells[J]. Cell Tissue Res, 2013, 353(1): 65-78.
doi: 10.1007/s00441-013-1630-x pmid: 23715720 |
| [17] |
Wang W, Zhu YR, Liu Y, et al. 3D bioprinting of DPSCs with GelMA hydrogel of various concentrations for bone regeneration[J]. Tissue Cell, 2024, 88: 102418.
doi: 10.1016/j.tice.2024.102418 |
| [18] |
Mattei V, Martellucci S, Pulcini F, et al. Regenerative potential of DPSCs and revascularization: Direct, paracrine or autocrine effect?[J]. Stem Cell Rev Rep, 2021, 17(5): 1635-1646.
doi: 10.1007/s12015-021-10162-6 pmid: 33829353 |
| [19] | Leyendecker Junior A, Gomes Pinheiro CC, Lazzaretti Fernandes T, et al. The use of human dental pulp stem cells for in vivo bone tissue engineering: A systematic review[J]. J Tissue Eng, 2018, 9: 2041731417752766. |
| [20] |
Liu FQ, Wu QQ, Liu QW, et al. Dental pulp stem cells-derived cannabidiol-treated organoid-like microspheroids show robust osteogenic potential via upregulation of WNT6[J]. Commun Biol, 2024, 7(1): 972.
doi: 10.1038/s42003-024-06655-y |
| [21] |
Kornsuthisopon C, Nowwarote N, Srisuwan T, et al. Regulatory pathways governing odonto/osteogenic differentiation in dental pulp stem cells[J]. Int Endod J, 2026, 59(3): 372-395.
doi: 10.1111/iej.v59.3 |
| [22] |
Aval SF, Lotfi H, Sheervalilou R, et al. Tuning of major signaling networks (TGF-β, Wnt, Notch and Hedgehog) by miRNAs in human stem cells commitment to different lineages: Possible clinical application[J]. Biomed Pharmacother, 2017, 91: 849-860.
doi: S0753-3322(17)31198-8 pmid: 28501774 |
| [23] |
Jerome LA, Papaioannou VE. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1[J]. Nat Genet, 2001, 27(3): 286-291.
doi: 10.1038/85845 pmid: 11242110 |
| [24] |
Komori T. Whole aspect of Runx2 functions in skeletal development[J]. Int J Mol Sci, 2022, 23(10): 5776.
doi: 10.3390/ijms23105776 |
| [25] |
Funato N, Srivastava D, Shibata S, et al. TBX1 regulates chondrocyte maturation in the spheno-occipital synchondrosis[J]. J Dent Res, 2020, 99(10): 1182-1191.
doi: 10.1177/0022034520925080 pmid: 32442036 |
| [26] |
Papangeli I, Scambler P. The 22q11 deletion: DiGeorge and velocardiofacial syndromes and the role of TBX1[J]. Wiley Interdiscip Rev Dev Biol, 2013, 2(3): 393-403.
doi: 10.1002/wdev.v2.3 |
| [27] |
Komori T. Regulation of skeletal development and maintenance by Runx2 and Sp7[J]. Int J Mol Sci, 2024, 25(18): 10102.
doi: 10.3390/ijms251810102 |
| [28] |
Shen JJ, Sun Y, Liu XZ, et al. EGFL6 regulates angiogenesis and osteogenesis in distraction osteogenesis via Wnt/β-catenin signaling[J]. Stem Cell Res Ther, 2021, 12(1): 415.
doi: 10.1186/s13287-021-02487-3 |
| [29] |
Cioffi S, Martucciello S, Fulcoli FG, et al. Tbx1 regulates brain vascularization[J]. Hum Mol Genet, 2014, 23(1): 78-89.
doi: 10.1093/hmg/ddt400 pmid: 23945394 |
| [30] |
Lungu CN, Mehedinti MC. Molecular motifs in vascular morphogenesis: Vascular endothelial growth factor A (VEGFA) as the leading promoter of angiogenesis[J]. Int J Mol Sci, 2023, 24(15): 12169.
doi: 10.3390/ijms241512169 |
| [31] |
Scott MA, Levi B, Askarinam A, et al. Brief review of models of ectopic bone formation[J]. Stem Cells Dev, 2012, 21(5): 655-667.
doi: 10.1089/scd.2011.0517 pmid: 22085228 |
| [32] |
Burckhardt K, Jung O, Stošić MR, et al. Comparative evaluation of biocompatibility data from the subcutaneous and the calvaria implantation model of a novel bone substitute block[J]. In Vivo, 2025, 39(6): 3116-3127.
doi: 10.21873/invivo.14113 |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||