重组人源化Ⅲ型胶原涂层促进聚醚醚酮表面细胞黏附与成骨分化的研究

doi:10.13591/j.cnki.kqyx.2026.07.005

Abstract

Abstract:

Objective To improve the surface bioactivity of polyetheretherketone (PEEK) by constructing a polydopamine (PDA)-mediated recombinant humanized type Ⅲ collagen coating. Methods A composite coating was fabricated using a two-step immersion method. Briefly, PEEK substrates were first immersed in a dopamine (DA) solution to form an in situ self-polymerized PDA intermediate layer (PDA-PEEK), followed by immersion in a recombinant humanized type Ⅲ collagen solution to obtain Col-PEEK. Surface characteristics were analyzed using scanning electron microscopy (SEM), water contact angle measurement, Fourier transform infrared spectrum (FTIR), and X-ray photoelectron spectroscopy (XPS). Human jaw bone marrow mesenchymal stem cells (hjBMMSCs) were used as a model. Cells were cultured either with complete medium (Control group) or with material extracts (PEEK, PDA-PEEK, and Col-PEEK groups), and cell proliferation was then evaluated using the CCK-8 assay. Cell adhesion morphology was observed microscopically. Osteogenic differentiation and mineralization were assessed by quantitative alkaline phosphatase (ALP) activity analysis and semi-quantitative alizarin red S (ARS) staining. The expression levels of osteogenesis-related genes were determined by RT-qPCR. Results SEM observations revealed that the coating was uniformly distributed without altering the microstructure of the substrate. The water contact angle of Col-PEEK was significantly reduced (P<0.05), indicating markedly improved hydrophilicity. FTIR and XPS analyses confirmed the successful immobilization of type Ⅲ collagen onto the PDA layer. CCK-8 assays demonstrated that the modified materials exhibited no cytotoxicity. Cells cultured on Col-PEEK displayed enhanced spreading and more filopodia formation. ALP activity and calcium nodule deposition were significantly increased(P<0.05), accompanied by a marked upregulation of key osteogenic gene expression(P<0.05). Conclusion The PDA-mediated recombinant humanized type Ⅲ collagen composite coating significantly enhances the hydrophilicity, cell adhesion, and osteoinductive activity of PEEK surfaces. This modification strategy provides a novel surface modification approach and experimental evidence for the clinical translation of PEEK in oral implantation and maxillofacial bone regeneration.

Key words: polyetheretherketone, surface modification, bioactivity, cell adhesion, osteogenic differentiation

CLC Number:

R783.1

MU Wenqing, LYU Ziang, SUN Jiajun, ZHENG Kai, ZHANG Wei. Recombinant humanized type Ⅲ collagen coating enhances cell adhesion and osteogenic differentiation on polyetheretherketone[J]. Stomatology, 2026, 46(7): 514-520.

Figures/Tables 5

Fig.1

Tab.1

Fig.2

Fig.3

Fig.4

References 29

[1]	Zaifman JM, Megalla M, Grace Z, et al. Orthopaedic sports injuries in an aging population: Current trends and future projections[J]. Phys Health A Multidiscip Approach, 2025, 17(6): 1192-1199.
[2]	Savio D, Bagno A. When the total hip replacement fails: A review on the stress-shielding effect[J]. Processes, 2022, 10(3): 612. doi: 10.3390/pr10030612
[3]	He MM, Huang Y, Xu H, et al. Modification of polyetheretherketone implants: From enhancing bone integration to enabling multi-modal therapeutics[J]. Acta Biomater, 2021, 129: 18-32. doi: 10.1016/j.actbio.2021.05.009
[4]	Gu XM, Sun XL, Sun Y, et al. Bioinspired modifications of PEEK implants for bone tissue engineering[J]. Front Bioeng Biotechnol, 2021, 8: 631616. doi: 10.3389/fbioe.2020.631616
[5]	Zheng Z, Liu PJ, Zhang XM, et al. Strategies to improve bioactive and antibacterial properties of polyetheretherketone(PEEK)for use as orthopedic implants[J]. Mater Today Bio, 2022, 16: 100402.
[6]	Liang XX, Li H, Hu TZ, et al. Experimental study on the effects of modification on the tribological properties of PEEK materials[J]. Polym Compos, 2026, 47(11):9955-9972. doi: 10.1002/pc.v47.11
[7]	Buck E, Li H, Cerruti M. Surface modification strategies to improve the osseointegration of poly(etheretherketone)and its composites[J]. Macromol Biosci, 2020, 20(2): e1900271.
[8]	Ma TT, Zhang JJ, Sun SY, et al. Current treatment methods to improve the bioactivity and bonding strength of PEEK for dental application: A systematic review[J]. Eur Polym J, 2023, 183: 111757. doi: 10.1016/j.eurpolymj.2022.111757
[9]	Pillai RR, Mohan L. Plasma surface modification of biomedical implants and devices: Emphasis on orthopedic, dental, and cardiovascular applications[J]. Prosthesis, 2025, 7(6): 143. doi: 10.3390/prosthesis7060143
[10]	Fu Q, Gabriel M, Schmidt F, et al. The impact of different low-pressure plasma types on the physical, chemical and biological surface properties of PEEK[J]. Dent Mater, 2021, 37(1): e15-e22. doi: 10.1016/j.dental.2020.09.020 pmid: 33148448
[11]	Li MS, Liu XY, Tian EK, et al. The role of collagen in mechanotransduction and its influence on bone metabolic activity[J]. Int J Biol Macromol, 2025, 318: 144968. doi: 10.1016/j.ijbiomac.2025.144968
[12]	Chen ZY, Fan DD, Shang LJ. Exploring thepotential of the recombinant human collagens for biomedical and clinical applications: A short review[J]. Biomed Mater, 2021, 16(1): 012001. doi: 10.1088/1748-605X/aba6fa
[13]	Xu LJ, Liu YF, Tang LZ, et al. Preparation of recombinant human collagen Ⅲ protein hydrogels with sustained release of extracellular vesicles for skin wound healing[J]. Int J Mol Sci, 2022, 23(11): 6289. doi: 10.3390/ijms23116289
[14]	Yang Y, Xu RZ, Wang CJ, et al. Recombinant human collagen-based bioinks for the 3D bioprinting of full-thickness human skin equivalent[J]. Int J Bioprinting, 2022, 8(4): 611.
[15]	Yang L, Wu HS, Lu L, et al. A tailored extracellular matrix(ECM)- mimetic coating for cardiovascular stents by stepwise assembly of hyaluronic acid and recombinant human type Ⅲ collagen[J]. Biomaterials, 2021, 276: 121055. doi: 10.1016/j.biomaterials.2021.121055
[16]	Hiratsuka T, Ogura I, Okamura A, et al. Bioresorbable bone graft composed of an RGD-enriched recombinant human collagen polypeptide induced neovascularization and regeneration of mature bone tissue[J]. ACS Appl Bio Mater, 2020, 3(12): 8592-8602. doi: 10.1021/acsabm.0c00986 pmid: 35019630
[17]	Dondani JR, Iyer J, Tran SD. Surface treatments of PEEK for osseointegration to bone[J]. Biomolecules, 2023, 13(3): 464. doi: 10.3390/biom13030464
[18]	Huang HG, Liu X, Wang JZ, et al. Strategies to improve the performance of polyetheretherketone(PEEK)as orthopedic implants: From surface modification to addition of bioactive materials[J]. J Mater Chem B, 2024, 12(19): 4533-4552. doi: 10.1039/D3TB02740F
[19]	Rahmati M, Silva EA, Reseland JE, et al. Biological responses to physicochemical properties of biomaterial surface[J]. Chem Soc Rev, 2020, 49(15): 5178-5224. doi: 10.1039/d0cs00103a pmid: 32642749
[20]	Wei XP, Lei LS, Luo L, et al. Advances in osteoimmunomodulation of biomaterials after intrabone implantation: Focus on surface hydrophilicity[J]. J Mater Chem B, 2024, 12(43): 11089-11104. doi: 10.1039/D4TB01907E
[21]	Arisaka Y, Masuda H, Yoda T, et al. Phototethering of collagen onto polyetheretherketone surfaces to enhance osteoblastic and endothelial performance[J]. Macromol Biosci, 2022, 22(8): 2200115. doi: 10.1002/mabi.v22.8
[22]	Zhao Y, Sun Q, Huo B. Focal adhesion regulates osteogenic differentiation of mesenchymal stem cells and osteoblasts[J]. Biomater Transl, 2021, 2(4): 312-322. doi: 10.12336/biomatertransl.2021.04.007
[23]	Ge CX, Li YM, Wu FS, et al. Synthetic peptides activating discoidin domain receptor 2 and collagen-binding integrins cooperate to stimulate osteoblast differentiation of skeletal progenitor cells[J]. Acta Biomater, 2023, 166: 109-118. doi: 10.1016/j.actbio.2023.05.039 pmid: 37245640
[24]	Komori T. Whole aspect of Runx2 functions in skeletal development[J]. Int J Mol Sci, 2022, 23(10): 5776. doi: 10.3390/ijms23105776
[25]	Komori T. Functions of osteocalcin in bone, pancreas, testis, and muscle[J]. Int J Mol Sci, 2020, 21(20): 7513. doi: 10.3390/ijms21207513
[26]	Liu HQ, Hu KP, Wu CW, et al. Electroactive PVTF films functionalized with collagen enhance osteogenic differentiation and bone regeneration[J]. Biomater Adv, 2026, 179: 214530. doi: 10.1016/j.bioadv.2025.214530
[27]	Qiu P, Bennani V, Cooper PR, et al. A review of the application of inorganic non-metallic coatings on PEEK dental implants[J]. Surf Interfaces, 2025, 72: 107027.
[28]	Kumar P. Plasma surface modification of biomaterials: Developing plasma-treated implants and prosthetics with improved biocompatibility[J]. Int J Phys Appl, 2025, 7(1): 266-275. doi: 10.33545/26647575
[29]	Park S, Jung TG. Surface modification of polyetheretherketone(PEEK)intervertebral fusion implant using polydopamine coating for improved bioactivity[J]. Bioengineering, 2024, 11(4): 343. doi: 10.3390/bioengineering11040343

基因	引物序列(5'—3')
ALP	F:TCACCAGGGGGATTTTGACAC R:GGGGGTATGGAACGTCTGAG
OCN	F:GGCAGCGAGGTAGTGAAGAGA R:CTCCTGAAAGCCGATGTGG
RUNX2	F:GACGAGGCAAGAGTTTCACC R:GGTTCCCGAGGTCCATCTAC
OPN	F:CTCCATTGACTCGAACGACTC R:CAGGTCTGCGAAACTTCTTAGAT
GAPDH	F:CAATGACCCCTTCATTGACC R:TTGATTTTGGAGGGATCTCG

Recombinant humanized type Ⅲ collagen coating enhances cell adhesion and osteogenic differentiation on polyetheretherketone

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 29

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	WANG Mingxi, GAO Shan, LI Guoqing, TANG Chunbo. Regulatory effect of transcription factor TBX1 on osteogenic differentiation of human dental pulp stem cells [J]. Stomatology, 2026, 46(6): 427-434.
[2]	WANG Jie, LI Na, YU Jinhua. Coffee inhibits osteogenic differentiation of rat bone marrow mesenchymal stem cells via suppression of the Wnt/β-catenin pathway [J]. Stomatology, 2026, 46(5): 337-343.
[3]	ZHANG Kewei, WANG Feiyang, LI Jiaojiao, YANG Chen, CHEN Wu, LI Lin, SHI Wenhui, CHEN Xiaomei, WANG Xiaoqian. Study on clinical effect of digital occlusal guided periodontal splint for periodontitis patients with loose teeth [J]. Stomatology, 2026, 46(4): 253-259.
[4]	WANG Xiaolei, SU Chang, ZHOU Zhongzheng, QIN Di, HUI Guangyan, WANG Zhongshan, WU Guangsheng. A comparative study on fish scales and Bio-Oss bone powder on osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration in vivo [J]. Stomatology, 2026, 46(2): 112-117.
[5]	LAI Minqin, HU Zonghao, QIN Zishun, YIN Lihua. Effects of paeoniflorin on proliferation and osteogenic differentiation of human jaw bone marrow mesenchymal stem cells in vitro [J]. Stomatology, 2026, 46(2): 118-125.
[6]	YU Chen, HE Longfei, FENG Yao, GE Xiao, CUI Yunting, LI Ti, YU Miao. The effect of Nel-like type 1 molecule on the proliferation and osteogenic differentiation of stem cells from human exfoliated deciduous teeth [J]. Stomatology, 2025, 45(7): 518-524.
[7]	WU Yuting, DAI Mingrui, LENG Diya, ZHU Tingting, WU Tao, WU Daming. Study on the promotion of osteo/odontogenic differentiation on SCAPs and anti-inflammatory effects of EGCG/CeO₂-loaded nanoparticles in an inflammatory microenvironment [J]. Stomatology, 2025, 45(7): 529-539.
[8]	GENG Mingzhu, MU Wenqing, QIU Lin, ZHANG Wei. miR-129-1-3p inhibits osteogenic differentiation of human bone marrow mesenchymal stem cells via BMP2/SMAD1 signaling pathway [J]. Stomatology, 2025, 45(6): 418-423.
[9]	NI Hao, LI Danxue. Research progress of metal-organic frameworks in implant surface modification [J]. Stomatology, 2025, 45(6): 475-480.
[10]	PENG Hanyu, LI Xiao. Progress of research on the effect of implant surface nano-morphology on osteoblast adhesion [J]. Stomatology, 2025, 45(2): 156-160.
[11]	DONG Weijie, SU Tingshu, XIN Xianzhen. Effects of quercetin loaded gelatin microspheres on proliferation and differentiation of MC3T3-E1 [J]. Stomatology, 2024, 44(7): 494-499.
[12]	LUO Yichen, QIU Lin, GENG Mingzhu, ZHANG Wei. Investigation on the retentive force and fatigue property of different designed polyetheretherketone clasps [J]. Stomatology, 2024, 44(5): 369-374.
[13]	PAN Le, DUAN Qinyan, CHENG Junxiang, HONG Feng, HU Yajun. Research progress of LncRNA-mediated miRNA regulating osteogenic differentiation of PDLSCs in microenvironment [J]. Stomatology, 2024, 44(3): 232-236.
[14]	DING Kexin, YANG Jinxin, MOU Jie, SUN Zhe, CUI Yawen, LIU Zongxiang. In vitro study on flavonoid NO donor nanoparticles promoting osteogenic differentiation of PDLSCs by regulating macrophage polarization [J]. Stomatology, 2024, 44(11): 806-814.
[15]	JIANG Zhen, HAN Xue, JIANG Beizhan. Research progress of the regulatory mechanisms of dental follicle in bone remodeling during tooth eruption [J]. Stomatology, 2023, 43(8): 752-756.